Supplementary Section to “When a helicase is not a helicase: dsDNA tracking by the motor protein EcoR124I”

pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzymes it was cloned between the XbaI and the SacI site of the vector. PCR fragment 2 (forward primer: AAAAGAATTCGGTGACCCTTACGCGAATCC, reverse primer AAAATCTAGAGGCTTCAGCGACCTTGTCC) copies the 9043 to 11201 bp region from λ-DNA. After digestion with the corresponding restriction enzymes it was cloned between the EcoRI and the XbaI site of the vector. PCR fragment 3 (forward primer: AAAACTCGAGCGGTCGTGCTGTATTGTCTC, reverse primer AAAAGAATTCCTCAGCCAGAGACACAGCCCCTCAGCAGAACTTCCATTA TTCTCCTG) copies the 21425 to 22661 bp region from λ-DNA. It contains a single EcoR124I site. The two 20 bp spaced, directly-repeated BbvCI sites for construction of the ssDNA gaps were added to the reverse primer (underlined in bold). After digestion with the corresponding restriction enzymes the PCR product was cloned between the XhoI and the EcoRI site of the vector. PCR fragment 4 (forward primer: AAAAGGTACCAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAACTCGAGCAGCAACCGCAAGAATGC) copies the 4236 to 5925 bp region from λ-DNA (same as fragment 1). After digestion with the corresponding restriction enzymes it was cloned between the KpnI and the XhoI site of the vector.